yabT [2019-08-15 13:02:25]

Ser/Thr kinase, controls Translation and DNA integrity during spore development

Locus: BSU_00660

Isoelectric point: 9.94

Molecular weight: 37.51 kDa

Protein length: 338 aa

Gene length: 1017 bp

Function: control of DNA integrity during spore development

Product: Ser/Thr kinase

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Protein synthesis, modification and degradation → Protein modification → Protein kinases
• Lifestyles → Sporulation → Sporulation proteins → Sporulation proteins/ other
• Groups of genes → Membrane proteins

Gene

Coordinates: 73,809 → 74,825

Phenotypes of a mutant

• increased sensitivity to DNA damage during spore development PubMed

The protein

Catalyzed reaction/ biological activity

• phosphorylation of RecA on Ser-2 PubMed
• phosphorylation of EF-Tu on Thr-63 during sporulation PubMed
• phosphorylation of YabA on Thr-71 PubMed
• ATP + L-seryl-[protein] --> ADP + H⁺ + O-phospho-L-seryl-[protein] (according to UniProt)
• ATP + L-threonyl-[protein] --> ADP + H⁺ + O-phospho-L-threonyl-[protein] (according to UniProt)

Protein family

• protein kinase superfamily (according to UniProt)
• Ser/Thr protein kinase family (according to UniProt)

Effectors of protein activity

• autophosphorylation is stimulated by non-specific binding to DNA PubMed

Structure

• 6G4J PubMed

Localization

• colocalizes strongly with the septal membrane separating the mother cells from the forespore PubMed

Expression and Regulation

Operons

• Genes: spoIIE-yabS-yabT-tilS-hprT-ftsH
  Description: PubMed

  Sigma factors

  • SigF: sigma factor, PubMed, in SigF regulon

  Regulation

  • expressed early during sporulation in the forespore (SigF) PubMed

Biological materials

Mutant

• MGNA-B921 (yabT::erm), available at the NBRP B. subtilis, Japan
• GP577 (erm), available in Jörg Stülke's lab
• BKE00660 (ΔyabT::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_TTTGATTGTCGTACCCGGCT, downstream forward: _UP4_TGAATGGTGCAAACTGCAGA
• BKK00660 (ΔyabT::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_TTTGATTGTCGTACCCGGCT, downstream forward: _UP4_TGAATGGTGCAAACTGCAGA

Expression vectors

• purification from B. subtilis with N-terminal Strep-tag, for SPINE, in pGP380: pGP391, available in Jörg Stülke's lab
• purification from E. coli with N-terminal Strep-tag, in pGP172: pGP823, available in Jörg Stülke's lab, PubMed
• purification from E. coli with N-terminal His-tag, in pWH844: pGP1408, available in Jörg Stülke's lab

LacZ fusion

• translational lacZ fusion (in pAC7): pGP831, available in Jörg Stülke's lab

References

Reviews

Loading

Original publications

Loading